rexresearch
John TAGG, et al.
Streptococcus salivarius K12 vs Halitosis

1. Lydia Ramsey : We've been fighting morning breath all wrong

2. J. Tagg, et al. : A preliminary study of the effect of probiotic Streptococcus salivarius K12 on oral malodour parameters.

3. J. Tagg, et al. : The rationale and potential for the reduction of oral malodour using Streptococcus salivarius probiotics.

4. J. Tagg, et al. : A preliminary study of the effect of probiotic Streptococcus salivarius K12 on oral malodour parameters.

5. Masdea L, et al. : Antimicrobial activity of Streptococcus salivarius K12 on bacteria involved in oral malodour.

6. J. Tagg, et al. : Developing Oral Probiotics From Streptococcus salivarius

7. BLIS K12, A futuristic supplement that is here and now

8. Patents

http://www.businessinsider.com/can-you-use-a-probiotic-to-fix-bad-breath-2015-11
14 November 2015
We've been fighting morning breath all wrong
Listerine doesn't work.

 by
Lydia Ramsey

In the near future, the cause of our stinky morning breath could be the thing that helps us beat it. Our body is filled with trillions microorganisms. Some of those microbes hang out in our mouth, which is nice and humid. While we sleep, our mouths sometimes dry out, which can kill off some good bacteria and cause gas-emitting bacteria to thrive. That's the reason you sometimes wake up with a putrid-smelling mouth.
But, there's a solution, and its name is Streptococcus salivarius K12. Researchers think the bacteria strain could soon be put into a lozenge or spray and used as a probiotic, or beneficial mix of bacteria, to knock out the bad bacteria that causes bad breath.

The delicate balance of microbes living inside each one of us, collectively called our microbiome, helps keep our body running. Unfortunately, things we do - like taking antibiotics, for example - can wipe out many of these beneficial microbes, throwing off the balance.
Susan Perkins, one of the curators of a recent exhibit at the American Museum of Natural History focused on the microbiome, told Business Insider she wouldn't be surprised if we started using bacteria to treat morning breath within the year.
A 2006 study of 23 people with halitosis, or bad breath, found that those given S. salivarius K12 lozenges had lower levels of smelly breath. The participants started by using an antimicrobial mouthwash followed by either a placebo lozenge or one with S. salivarius K12. They found that the addition of the bacteria reduced the levels of smelly breath better than the mouthwash on its own.

Ideally, this probiotic could be used in addition to mouthwashes like Listerine, which kill all the bacteria - good and bad - in your mouth. Andrea Azcarate-Peril, the director of the University of North Carolina's Microbiome Research Core, told Business Insider that antibacterial solutions like mouthwash and hand sanitiser are being overused to the point where they could be doing more harm than good.
"We are just too clean," she said.
But probiotics aren't a perfect solution either. At least not yet. We still don't know everything about the bacteria in our bodies, and not every probiotic works for every person. Plus, probiotics still aren't regulated by the FDA, so it's a little tricky to know if the supplements people are taking are actually doing what they say they are.

Even so, the probiotics industry is expanding. The hope is to eventually use these probiotics to treat everything from cancer to bad body odour, said Perkins.
In the meantime, keep your eye out for S. salivarius K12.


http://www.ncbi.nlm.nih.gov/pubmed/16553730
J Appl Microbiol. 2006 Apr;100(4):754-64.
A preliminary study of the effect of probiotic Streptococcus salivarius K12 on oral malodour parameters.

Burton JP, Chilcott CN, Moore CJ, Speiser G, Tagg JR.

Abstract

 AIMS:
To determine whether dosing with bacteriocin-producing Streptococcus salivarius following an antimicrobial mouthwash effects a change in oral malodour parameters and in the composition of the oral microbiota of subjects with halitosis.
MATERIALS AND RESULTS:
Twenty-three subjects with halitosis undertook a 3-day regimen of chlorhexidine (CHX) mouth rinsing, followed at intervals by the use of lozenges containing either S. salivarius K12 or placebo. Assessment of the subjects' volatile sulphur compound (VSC) levels 1 week after treatment initiation showed that 85% of the K12-treated group and 30% of the placebo group had substantial (>100 ppb) reductions. The bacterial composition of the saliva was monitored by culture and PCR-denaturing gradient gel electrophoresis (PCR-DGGE). Changes in the PCR-DGGE profiles occurred in most subjects following K12 treatment. In vitro testing showed that S. salivarius K12 suppressed the growth of black-pigmented bacteria in saliva samples and also in various reference strains of bacteria implicated in halitosis.
CONCLUSIONS:
Administration of bacteriocin-producing S. salivarius after an oral antimicrobial mouthwash reduces oral VSC levels.
SIGNIFICANCE AND IMPACT OF THE STUDY:
The outcome of this preliminary study indicates that the replacement of bacteria implicated in halitosis by colonization with competitive bacteria such as S. salivarius K12 may provide an effective strategy to reduce the severity of halitosis.

http://www.ncbi.nlm.nih.gov/pubmed/15752094
Oral Dis. 2005;11 Suppl 1:29-31.
The rationale and potential for the reduction of oral malodour using Streptococcus salivarius probiotics.
Burton JP, Chilcott CN, Tagg JR.

Abstract

The primary treatment for oral malodour is the reduction of bacterial populations, especially those present on the tongue, by use of a variety of antimicrobial agents or mechanical devices. However, shortly after treatment the problematic bacteria quickly repopulate the tongue and the malodour returns. In our studies, we have used a broadly-active antimicrobial (chlorhexidine) to effect temporary depletion of the oral microbiota and then have attempted to repopulate the tongue surface with Streptococcus salivarius K12, a benign commensal probiotic. The objective of this is to prevent re-establishment of non-desirable bacterial populations and thus help limit the re-occurrence of oral malodour over a prolonged period. In this paper, we discuss why contemporary probiotics are inadequate for treatment of oral malodour and examine the rationale for selection of particular bacterial species for future use in the treatment of this condition. In our preliminary trials of the use of a chlorhexidine rinse followed by strain K12 lozenges, the majority (8/13) of subjects with confirmed halitosis maintained reduced breath levels of volatile sulphur compounds for at least 2 weeks. We conclude that probiotic bacterial strains originally sourced from the indigenous oral microbiotas of healthy humans may have potential application as adjuncts for the prevention and treatment of halitosis.

http://www.ncbi.nlm.nih.gov/pubmed/16553730
J Appl Microbiol. 2006 Apr;100(4):754-64.
A preliminary study of the effect of probiotic Streptococcus salivarius K12 on oral malodour parameters.
Burton JP, Chilcott CN, Moore CJ, Speiser G, Tagg JR.

Abstract

AIMS:
To determine whether dosing with bacteriocin-producing Streptococcus salivarius following an antimicrobial mouthwash effects a change in oral malodour parameters and in the composition of the oral microbiota of subjects with halitosis.
MATERIALS AND RESULTS:
Twenty-three subjects with halitosis undertook a 3-day regimen of chlorhexidine (CHX) mouth rinsing, followed at intervals by the use of lozenges containing either S. salivarius K12 or placebo. Assessment of the subjects' volatile sulphur compound (VSC) levels 1 week after treatment initiation showed that 85% of the K12-treated group and 30% of the placebo group had substantial (>100 ppb) reductions. The bacterial composition of the saliva was monitored by culture and PCR-denaturing gradient gel electrophoresis (PCR-DGGE). Changes in the PCR-DGGE profiles occurred in most subjects following K12 treatment. In vitro testing showed that S. salivarius K12 suppressed the growth of black-pigmented bacteria in saliva samples and also in various reference strains of bacteria implicated in halitosis.
CONCLUSIONS:

Administration of bacteriocin-producing S. salivarius after an oral antimicrobial mouthwash reduces oral VSC levels.
SIGNIFICANCE AND IMPACT OF THE STUDY:

The outcome of this preliminary study indicates that the replacement of bacteria implicated in halitosis by colonization with competitive bacteria such as S. salivarius K12 may provide an effective strategy to reduce the severity of halitosis.

Arch Oral Biol. 2012 Aug;57(8):1041-7.
doi: 10.1016/j.archoralbio.2012.02.011.
Epub 2012 Mar 10.
Antimicrobial activity of Streptococcus salivarius K12 on bacteria involved in oral malodour.
Masdea L, Kulik EM, Hauser-Gerspach I, Ramseier AM, Filippi A, Waltimo T.

Abstract

OBJECTIVE:
To investigate the antimicrobial activity of the bacteriocin-producing strain Streptococcus salivarius K12 against several bacteria involved in halitosis.
DESIGN:
The inhibitory activity of S. salivarius K12 against Solobacterium moorei CCUG39336, four clinical S. moorei isolates, Atopobium parvulum ATCC33793 and Eubacterium sulci ATCC35585 was examined by a deferred antagonism test. Eubacterium saburreum ATCC33271 and Parvimonas micra ATCC33270, which have been tested in previous studies, served as positive controls, and the Gram-negative strain Bacteroides fragilis ZIB2800 served as a negative control. Additionally, the occurrence of resistance in S. moorei CCUG39336 to S. salivarius K12 was analysed by either direct plating or by passage of S. moorei CCUG39336 on chloroform-inactived S. salivarius K12-containing agar plates.
RESULTS:
S. salivarius K12 suppressed the growth of all Gram-positive bacteria tested, but the extent to which the bacteria were inhibited varied. E. sulci ATCC35585 was the most sensitive strain, while all five S. moorei isolates were inhibited to a lesser extent. Natural resistance seems to be very low in S. moorei CCUG39336, and there was only a slight decrease in sensitivity after exposure to S. salivarius K12 over 10 passages.
CONCLUSION:
Our studies demonstrate that S. salivarius K12 has antimicrobial activity against bacteria involved in halitosis. This strain might be an interesting and valuable candidate for the development of an antimicrobial therapy for halitosis.

http://www.medscape.com/viewarticle/777316_4
Future Microbiol. 2012;7(12):1355-1371.
[ Excerts ]
Developing Oral Probiotics From Streptococcus salivarius
Philip A Wescombe; John DF Hale; Nicholas CK Heng; John R Tagg

Development of S. salivarius Probiotics: General Principles

The Food and Agricultural Organization and WHO have published a list of recommended guidelines for the systematic assessment and development of strains that are under consideration as probiotics.[2] While this document focuses particularly on intestinal probiotics, its recommendations can be considered generally applicable to all probiotics. Some of the key steps taken in the commercial development of a probiotic are shown in Figure 1. It is important to note that, in practice, the process does not always follow an orderly pathway (especially in the developmental stage), and that some steps may prove especially problematic and need to be repeated prior to obtaining a successful and efficacious end-product.
Steps required for the development of a probiotic.

Candidate Screening & Selection...
Safety Evaluation...

 Stability & Shelf Life...
Probiotic Production...
Profiles of Proposed S. salivarius Probiotics: Past, Present & Potential

Early Entries...
Current Contenders

S. salivarius K12

Although S. salivarius K12 was initially selected on the basis of its broad inhibitory activity against S. pyogenes, it has subsequently been demonstrated to provide more diverse health benefits – ranging from the alleviation of halitosis to stimulation of antiviral immune defenses and the reduction of episodes of OM. This broad spectrum of potential health benefits conferred throughout the life of the human host has prompted the adoption of the colloquial moniker for this strain, "BLIS K12 – the probiotic for all ages" (Figure 2).


Streptococcus salivarius: the probiotic for all ages. Diseases that may be alleviated by Streptococcus salivarius probiotics and the ages at which they generally tend to manifest.
Reproduced with permission from [77].

Figure 3. Electron microscope image demonstrating the attachment of Streptococcus salivarius K12 to HEp-2 cells.
 Image courtesy of M Rohde.

In 2001, strain K12 became the first S. salivarius to be commercially developed as a probiotic and more than 50 million doses have now been marketed internationally by the New Zealand company BLIS Technologies Ltd (Dunedin, New Zealand). A substantial body of research was undertaken to underpin the safe and efficacious application of the strain to humans and this included a variety of clinical interventions in both animals and humans. Although S. salivarius is not commonly consumed as a naturally occurring food ingredient, it is nevertheless considered a low-risk organism since, in spite of its apparently invariable and plentiful presence in the human oral cavity, it is only very rarely a cause of infection in humans who are immunologically competent.[27] The safety of strain K12 has been specifically supported by a series of studies: affirming the absence of known streptococcal virulence factors and antibiotic resistance determinants; showing its low mutagenicity predisposition; acute and subacute toxicity testing in rats; and a high-dosage trial in humans.[29,35,36] The outcome of these strain-specific studies, together with recognition of the inherent safety of the species, has enabled a self-affirmed 'generally regarded as safe' (or 'GRAS') status to be granted for strain K12 in the USA. Interestingly, the species S. salivarius is still generally classified as a risk group 2 organism in Europe; however, on the basis of its safety profile strain, K12 has been specifically reclassified as a risk group 1 organism in Germany by the Ausschuß für Biologische Arbeitsstoffe (Translation: Committee on Biological Agents).[43]
The original source of S. salivarius K12 was a healthy schoolchild who had maintained a large indigenous oral cavity population of the K12 strain for a period of more than 12 months, during which time no new S. pyogenes infections were experienced. A distinctive (and indeed patentable) feature of strain K12 was its production of two novel lantibiotics (salivaricin A2 and B), both of which were shown in vitro to have inhibitory activity against S. pyogenes, the principal causative agent of streptococcal pharyngitis.[44] Further support, albeit indirect, for the protection offered by S. salivarius BLIS against S. pyogenes infection came from studies showing that children who harbored oral populations of salivaricin A- and/or B-producing S. salivarius had significantly fewer new acquisitions of S. pyogenes than did children who appeared not to have BLIS-producing S. salivarius (17 vs 32%, respectively).[45] Another study showed that children who frequently experienced clinically confirmed sore throats were significantly less likely to have BLIS-producing S. salivarius than children who had not experienced sore throats in the past 3 years.[46] Furthermore, competition experiments between cocultured strain K12 and a bioluminescent S. pyogenes demonstrated that strain K12 binds avidly to human epithelial cell lines and can interfere with the binding of S. pyogenes[28,47] (Figure 3). Oral cavity colonization of humans occurs following its introduction into the mouth and the efficacy of this colonization is enhanced by prior reduction of the levels of the indigenous streptococcal population, as occurs following the use of an antiseptic mouth rinse (e.g., chlorhexidine) or after antibiotic treatment.[15,48,49] Recent, as yet unpublished, studies have also demonstrated that the use of one lozenge a day containing 1 billion viable cfu of strain K12, is sufficient to achieve oral cavity colonization in the majority of subjects [WESCOMBE PA ET AL., UNPUBLISHED DATA]. Further evidence for the protection afforded by strain K12 against streptococcal pharyngitis was gathered during a small preliminary trial in which 24 children with a history of recurrent tonsillitis (0.33 episodes per month) received daily doses of either strain K12 or a placebo. The 18 children receiving strain K12 experienced fewer sore throats (0.10 per month) than did the six children in the placebo group (0.19 per month) [BURTON JP ET AL., UNPUBLISHED DATA].
S. salivarius, Rothia mucilaginosa and an uncharacterized species of Eubacterium were identified as being present in either relatively reduced numbers or absent in tongue dorsum populations of subjects suffering from halitosis.[50] Prompted by this observation, a trial of 23 subjects with halitosis (having breath scores for volatile sulfur compound [VSC] levels of greater than 200 ppb) undertook a 3-day regimen of chlorhexidine mouth rinsing, followed, at intervals, by the use of lozenges containing either S. salivarius K12 or placebo.[49] Assessment of the subjects' VSC levels 1 week after treatment initiation demonstrated that 85% of the K12-treated group and 30% of the placebo group had substantial (>100 ppb) VSC level reductions. While the majority of the subjects tested had a favorable outcome, the mechanism(s) of VSC reduction was not clearly established. In vitro tests showed that the inhibitory spectrum of strain K12 encompasses some of the key Gram-negative anaerobes (including Prevotella spp.) that have been implicated in halitosis.[49] Other mechanisms of competition (e.g., saturation of attachment sites by the newly introduced K12 cells) may also have been influential, particularly as facilitated by the chlorhexidine pretreatment step, which may have reduced populations of some critical adjunct members of the halitosis-associated consortia. Subsequent colonization of the microbe-depleted site by the incoming K12 could also limit anaerobe proliferation through specific BLIS-mediated inhibition of key members of the halitosis-associated microbiota.
OM is the most common bacterial infection in young children and the predominant etiological agents are Streptococcus pneumoniae, S. pyogenes, Moraxella catarrhalis and Haemophilus influenzae. As a preliminary experiment to evaluate the efficacy of probiotic interventions for the control of OM, it was shown that S. salivarius K12, when given to 19 young OM-susceptible children following a 3-day course of amoxicillin, led to colonization of the nasopharynx and/or the adenoid tissue of some subjects.[51] Interestingly, in that study, only 33% of the subjects achieved oral colonization with strain K12. This lower-than-anticipated level of colonization was attributed to the failure of the amoxicillin pretreatment to effect a substantial reduction in the level of the indigenous oral streptococcal populations, since most of these subjects had been preconditioned to regular amoxicillin exposure during the course of their OM therapy.[51] To determine whether delivery of the S. salivarius K12 probiotic to the oral cavity would have any effect on the rate of recurrence of OM, a small study was undertaken at Dunedin Hospital BURTON JP ET AL., UNPUBLISHED DATA. The 13 children enrolled in the study were from the surgical waiting list for grommet implants and all had a history of recurrent acute OM (AOM). The subjects were offered a three-month treatment course of either strain K12 or placebo and nine completed the study. The children receiving the K12 probiotic (n = 6) had far fewer ear infections (0.22 per month) than they did prior to entering the study (0.50 per month, n = 13) and also by comparison with the smaller placebo group (0.55 occurences per month, n = 3) BURTON JP ET AL., UNPUBLISHED DATA. The encouraging results of this study (although only preliminary) indicate that S. salivarius K12 dosing could potentially reduce the occurrence of OM.
An unanticipated application of S. salivarius K12 could be to ameliorate the development of oral candidosis. A number of early studies indirectly demonstrated that S. salivarius may inhibit oral candida,[52–55] but more recently Ishijima et al.[20] found a direct protective effect against Candida albicans after oral dosing with strain K12. In this latest study, K12 was shown to bind preferentially to the hyphae of C. albicans and to prevent its attachment to a plastic substratum. Interestingly, K12 was not able to directly inhibit C. albicans in a deferred antagonism assay, indicating that the bacteriocins encoded for by strain K12 do not target yeast and further supporting other observations that mechanisms other than the ability to target pathogens with antimicrobial molecules can also contribute to the health benefits of probiotics. When tested using an in vivo mouse model for oral candidosis, a dose-dependent improvement in symptom score was observed for mice dosed with K12 at 24 and 3 h before and at 3, 24 and 27 h after C. albicans inoculation, when compared with mice in a saline-treated group. Follow-up clinical evaluation of the efficacy of K12 in candidosis control in humans now seems imperative.
Although it is now well established that exposure to probiotic bacteria can impact upon the host's immune system, the outcome of these interactions can be quite strain-specific. Several in vitro cell culture experiments have indicated that strain K12 can help to maintain cell homeostasis. In one microarray-based study, it was demonstrated that co-culture with either strain K12 or certain bacterial pathogens differentially influenced the expression levels of 1530 genes in human bronchial epithelial cells.[56]S. salivarius K12 altered the expression of 660 genes (572 of which were specific to K12) and, in particular, those involved in innate immune defense pathways, general epithelial cell function and homeostasis, cytoskeletal remodeling, cell development and migration, and signaling pathways. In this same study, Staphylococcus aureus influenced the expression of 323 genes. The ratio of upregulated to downregulated genes was 5:2 for K12, but this ratio was reversed for S. aureus, further illustrating the different signaling roles of strain K12 and bacterial pathogens. Closer analysis of the affected gene pathways indicated that K12 potentially contributes to the maintainance of homeostasis between human and bacterial cells by reducing proinflammatory responses. In particular, K12 was shown, by enzyme-linked immunosorbent assay, to reduce the levels (from 318 to 5.1 pg/ml) of the cytokine IL-8 produced by the bronchial cell line in response to the presence of Pseudomonas aeruginosa.[56] IL-8 has been demonstrated to have a major involvement in the pathogenesis of gingivitis and so dosing with strain K12 may potentially help ameliorate some of the inflammatory manifestations of this disease. The secretion of Gro-α, an inducible neutrophil chemotactic factor synthesized in epithelial tissues during inflammation, was also inhibited by the presence of strain K12 when the epithelial cells were exposed to flagellin (a known inducer of IL-8 secretion by epithelial cells), further emphasizing the protective role strain K12 can play for the host. The mechanism of immunosuppression by strain K12 appeared to be at least partially explained through the inhibition of activation of the NF-κB pathway (a family of transcription factors that function as dimers and regulate genes involved in immunity, inflammation and cell survival). Interestingly, the most significantly over-represented pathway in the array studies was the unified interferon signaling pathway. In this pathway, type I and II interferons signal through their specific receptors to upregulate the expression of a large number of genes responsible for innate immunity against viral infection, antitumor activity, priming of the LPS response and anti-inflammatory effects. This indicates that, while K12 cells can act to reduce inflammation, they may also 'prime' the epithelial cells through tonic signaling to respond rapidly and appropriately to the detection of viral or bacterial exposure in order to limit the spread of infection – a role that has recently been ascribed, in general, to commensal bacteria.[57]
Other preliminary studies have demonstrated that high-level oral dosing with S. salivarius K12 elicits increased salivary levels of IFN-γ.[58] These observations were further supported by investigations with mouse splenocytes, in which IFN-γ levels, but not the pro-inflammatory cytokines IL-1β or TNF-α, were increased in response to co-culturing with strain K12 [WALES J ET AL., UNPUBLISHED DATA]. Interestingly, it seems that not all S. salivarius elicit similar immune responses, since S. salivarius strain ATCC 25975 was reported to upregulate IL-6, IL-8 and TNF-α gene expression.[59] Indeed, in that study it seemed that strain ATCC 25975 was even more efficient at inducing the release of proinflammatory mediators than was C. albicans. These apparently contradictory findings emphasize the importance of not extrapolating the specific findings for one probiotic candidate strain to all members of that same species. The initial findings of induction by strain K12 of an anti-inflammatory response have subsequently been independently corroborated by Guglielmetti et al.,[47] who showed that IL-6, IL-8 and TNF-α levels were significantly reduced when FaDu cells were co-cultured with K12. These findings will be discussed below in relationship to the probiotic candidate strain S. salivarius ST3.
In summary, it appears that strain K12 is well suited for use as an oral cavity and upper respiratory tract probiotic due to its natural propensity to inhabit the human oral cavity and be strongly competitive with a number of potential oral pathogens that have adapted to the same ecological niche. In addition, the immune responses of cell lines to co-incubation with S. salivarius K12 indicate that it elicits no proinflammatory response but rather an anti-inflammatory response, as well as modulating genes associated with adhesion to the epithelial layer and homeostasis. By these strategies, S. salivarius K12 appears to be well-tolerated on the epithelial surface, while also actively protecting the host by BLIS-mediated inhibition of pathogen replication and stimulation of cytokine-mediated reduction of virus replication and pathogen-induced inflammation and apoptosis.
S. salivarius M18

Some early reports indicated that certain S. salivarius strains (especially TOVE-R as aforementioned) may have a role in the limitation of dental caries. Following the successful discovery and introduction of the probiotic strain K12, BLIS Technologies Ltd. conducted extensive follow-up deferred antagonism testing of candidate BLIS-producing S. salivarius to identify strains having inhibitory spectra that included bacterial species putatively associated with the development of dental caries. In this screen, S. salivarius strain M18 (formerly known as Mia) was found to inhibit all tested S. mutans and S. sobrinus (collectively referred to as the mutans streptococci). Other species inhibited by strain M18 included: Actinomyces viscosus, Actinomyces naeslundii, Streptococcus agalactiae, Streptococcus pneumoniae, Enterococcus faecalis, Listeria monocytogenes, H. influenzae, Staphylococcus saprophyticus and Staphylococcus cohnii.[101] This unusually broad spectrum of inhibition indicated that strain M18, in addition to potentially reducing the risk of dental caries, may also have additional benefits for the host in helping to limit the growth of a variety of common bacterial pathogens of the upper respiratory tract.
To date, four bacteriocin loci have been identified in the M18 genome: salivaricin A2,[101] 9,[60] MPS[30] and M.[30] Salivaricin A2 and 9 are well-characterized bacteriocins with broad activity against S. pyogenes as well as other upper respiratory tract pathogens, but not against mutans streptococci. Salivaricin MPS is less well characterized, but is known to be a large 60 kDa bacteriocin with specific activity against S. pyogenes.[61] Salivaricins A2, 9 and MPS have been found to be megaplasmid-encoded in strain M18.[16,30] By contrast, salivaricin M appears to be chromosomally encoded and, recently, has not only been shown to be a lantibiotic, but also to be the molecule responsible for the observed activity of strain M18 against mutans streptococci.[30] Interestingly, unlike most other S. salivarius bacteriocins, salivaricin M appears to be optimally produced in vitro on TSYCa agar (trypticase soy broth supplemented with 2% yeast extract, 0.1% CaCO3 and 1.5% agar), and less effectively on BaCa (blood-containing) agar in deferred antagonism assays, an observation indicating that there is strict regulation of its locus expression.
Preliminary colonization trials have indicated that, in children who colonize well with strain M18, the salivary levels of mutans streptococci are maintained at reduced levels for significant periods (at least 27 days) by comparison with placebo-dosed control subjects, in whom the mutans streptococci levels returned to pretreatment levels within 4–6 days.[101,62]
A variety of pathogens have been implicated in the development of gingivitis and periodontitis and it has also been shown that the etiology of these diseases is strongly linked to the inflammatory response of the host cells to the bacterial pathogens.[63,64] To determine whether strain M18 can potentially impact on pathogen-induced pro-inflammatory cytokine expression in gingival fibroblasts, strains M18 and K12 were coincubated with gingival fibroblasts both prior to and concommitantly with exposure to periodontal pathogens such as Porphyromonas gingivalis, Aggregatibacter actinomycetemcomitans and Fusobacterium nucleatum. Strains M18 and K12 both significantly inhibited the expression of the pro-inflammatory cytokines IL-6 and -8, commonly associated with gingivitis – indicating that dosing with these probiotics may potentially be useful in the treatment of gingivitis.[65] Appropriately controlled large-scale clinical trials further investigating the potential for M18 probiotic interventions in the control of dental caries and gingivitis now appear warranted.
New Nominations

S. salivarius ST3
...Ability to produce urease was another characteristic assessed for each of the candidate probiotic strains. Strains K12 and RS1 were demonstrated both to be strongly ureolytic, a trait considered beneficial due to its effect in reducing the acidity of dental plaque and, thereby, possibly delaying the onset and progression of dental caries.[70,71] By contrast, strain ST3 appeared non-ureolytic and, on further examination, was found to lack ureC, which encodes the main subunit of the urease complex.[18] The authors suggested that the inability to hydrolyze urea could be considered beneficial, in that it could result in there being less damage to the host's mucosal cells from exposure to ammonia. These observations highlight the potential for different strains to fulfill different roles in the oral cavity and, perhaps, for them to be targeted to applications in individuals with specific health needs....
...Both strains were also found to grow efficiently in milk, indicating that fermented milk products may be suitable delivery vehicles for the probiotics.[19]
S. salivarius 24SMB
S. salivarius T30
Future Perspective

With the recent rapid expansion in the variety of available probiotics and in their delivery vehicles, consumers are developing a growing enthusiasm for the health benefits to be derived from their consumption. While the majority of probiotics have been designed for use in the GI tract, it is clear that there is now an impetus to progress the field to encompass other regions of the body, including the oral cavity. As this review has shown, there are now a number of candidate probiotic strains from the species S. salivarius that have been proposed for application to the control of microbial diseases of the oral cavity. While the safety of S. salivarius for application to humans appears to have been well established, there is still only relatively limited clinical evidence to support claims of health benefit. Most current supporting evidence has been based on either in vitro studies or the results of clinical trials that have been limited in size. There is no doubt that, in the next few years, the benefits to be gained from these probiotics (both in terms of health and commercial gain) will provide the incentive for clinical studies of sufficient magnitude to clearly establish the roles that S. salivarius probiotics can play in the human oral cavity, the upper respiratory tract and beyond (Figure 4). It is also apparent that, due to strain variation (even in the immunological responses that they evoke), individual strains will be selected for their specific health benefits which could include the prevention of: dental caries; OM; streptococcal sore throat; halitosis; oral thrush; general immune priming and potentially many more (Table 1). This promises to be a rapidly evolving and rewarding research area to observe and to participate in over the next decade.

http://www.blisk12.com/tag/lozenges/
BLIS K12, A futuristic supplement that is here and now

Just imagine popping an Altoid-type mint into your mouth, and while refreshing your breath, it also supplies beneficial bacteria to build a protective barrier in your mouth that can help support your upper respiratory system health.  Though that may seem like a concept from the future, the future is actually here and now.  Oral probiotic, BLIS K12®, adds pertinent “good bacteria” to the oral cavity and is the first of its kind to target this area of the body.  It was discovered by Dr. John Tagg of the University of Otago, when studying the mouths of individuals who had exceptional oral and upper respiratory health.
Scientific research continues to expand our knowledge of the bacteria that inhabit our intestinal tract and the substantial benefits from probiotic supplementation.  However, we are now beginning to gain an understanding of the importance of the bacteria that reside in other parts of our bodies such as our oral cavity, and how probiotic supplementation targeted to this area can play a crucial role in supporting overall health.  The BLIS K12® oral probiotic can help maintain health in the mouth (breath, teeth and gums), throat, and inner ear.
Supplements containing BLIS K12® can be found internationally in the form of chewing gum, lozenges, fast-melt tablets, chewable tablets, and powders.


Patents

 US8057790
TREATMENT OF MALODOUR

NZ546406
Treatment of halitosis with BLIS-producing S. salivarius

US6773912
Lantibiotic

WO2004072272
BACTERIAL COMPOSITIONS

NZ536689
Streptococcus salivarius strain and extract having anti-mutans Streptococci activity
[ Excerpts ]
TW200400262
 Antimicrobial composition

This invention provides novel Streptococcus salivarius, compositions containing same, and use of S. salivarius strains as antimicrobial agents. The strains are bacterial inhibitors with respect to at least S. mutans and/or MS and therefore have a number of therapeutic applications. The applications include but are not limited to forming part of therapeutic formulations for use in controlling, treating, or preventing dental caries.
BACKGROUND

Dental caries is a disease characterised by dissolution of the mineral portion of the tooth. As caries progresses, destruction of tooth enamel and dentine occurs followed by inflammation of pulp and periapical tissues.
The mutans streptococci (MS) are a cluster of acidogenic, dental plaque-inhabiting streptococcal species that are considered the principal causative agents of caries. Presently, seven different MS species (known as S. mutans, S. rattus, S. cricetus, S. sobrinus, S. ferus, S. macacae, and S. downei) are recognised. Of these seven species it is mainly S. mutans and S. sobrinus that are of significance in terms of human caries.
Over the years various methods have been developed and tried with varying results, to prevent or at least alleviate the problem of dental caries. Treatments with antibiotics such as penicillin have been suggested and are effective but indiscriminately destroy both useful and harmful bacteria in the mouth leading to microbial imbalances.
In order to minimise disruption to the mouth microflora, antibiotic producing organisms have been investigated for their ability to inhibit caries. A group of organisms identified as having potential in this regard are microorganisms producing bacteriocin-like inhibitory substances (BLIS). BLIS producers of the genera Streptococcus, Staphylococcus and Enterococcus have been screened for potential application to prevention of dental caries (Balakrishnan, M. et al., Caries Res. 2001 ; 35: 75-80).
What is sought is a non-virulent analog of the disease-causing S. mutans, or a so called effector strain. To serve as an effector strain in replacement therapy in bacterial infection, the microorganism must be non-virulent itself and able to compete successfully with the pathogenic microorganism either via competitive action and/or antibiotic action. S. mutans effector strains have been identified (Hillman et al. , J Dent Res. 1987; 66: 1092-4; James and Tagg, N Z Dent J. 1991; 87: 80-3) and show strong anti-S. mutans activity. A disadvantage with the use of S. mutans effector strains is the cariogenic potential of these strains.
S. salivarius is an alternative streptococcus species which avoids this disadvantage. In WO 01/27143 S. salivarius strains are identified which have utility in the treatment of dental caries caused at least in part by S. sobrinus. No activity was recorded against MS generally or S mutans in particular. Similarly, in Balakrishnan (supra), S. salivarius K3 is identified as active against S sobrinus when grown on trypticase soy broth yeast extract calcium carbonate agar medium, but had no effect on S. mutans.
S. salivarius TOVE-R (Tanzer, J. M. et al.; Infect Immun. , 1985, 48 : 44-50) is an antagonist strain and which brought about a reduction in dental caries. There have been no reports of BLIS production by this strain.
The applicants have now identified BLIS-producing S. salivarius strains with a broad spectrum of activity against MS dental caries causing organisms including S. mutans.
The present invention is broadly directed to these novel S. salivarius strains, and the use of anti-MS S. salivarius strains in the treatment of dental caries, or at least provides the public with a useful choice.
SUMMARY OF THE INVENTION

Accordingly, in one aspect, the present invention may broadly be said to consist in a biologically pure culture of a Streptococcus salivarius strain which is a Salivaricin A2 producer and which exhibits anti-MS activity, with the proviso that the strain is not S. salivarius K12 (Kl2).
In another aspect, the invention provides a biologically pure culture of a Streptococcus salivarius strain which is a Salivaricin A2 producer, exhibits anti-MS activity, and for carbohydrate metabolism is positive for at least one of L-arabinose, inulin, glycogen, xylitol, and (3-gentiobiose use, or (3-galactosidase production; and/or is negative for at least one of glycerol, a-methyl-D-mannoside use, or alkaline phosphoaase production.
Preferably, the strain is positive for each of L-arabinose, inulin, glycogen, xylitol, and ss- gentiobiose use, or p-galactosidase production; and/or is negative for each of glycerol, a- methyl-D-mannoside use, or alkaline phosphatase production.
The invention further provides a biologically pure culture of Streptococcus salivarius strain Mia on deposit at Deutsche Sammlung von Mikroorganismen Und Zellkulturen GmbH, Mascheroder Weg 1 b, D-38124, Braunschweig, Germany, Accession No. DSM 14685, or a culture having the identifying characteristics thereof.
The invention also provides an extract obtainable from Salivaricin A2-producing strains of S. salivarius, which extract has anti-MS activity. In particular, the extract has anti-S. mutans activity. Conveniently, the extract is obtainable from S. salivarius strains Mia or K12.
In a further aspect, the present invention provides an antibacterial composition which includes an S. salivarius or extract as defined above.
In a still further aspect, the present invention provides a therapeutic formulation comprising an S. salivarius or extract as defined above, together with a diluent, carrier and/or excipient.
In one embodiment, the composition or formulation further comprises a secondary antibacterial agent.
In one embodiment, the therapeutic formulations are in the form of foods or drinks, preferably in the form of a dairy product-based food or drink. Alternative forms are medicaments, lozenges and confectionaries.
The invention further provides a method for at least inhibiting the growth of bacteria sensitive to S. salivarius of the invention, the method comprising contacting the sensitive bacteria with an inhibitory effective amount of an S. salivarius, extract or composition or formulation of the invention.
Preferably the sensitive bacteria are MS, and more preferably S. mutans.
The invention provides in another aspect a method for at least inhibiting the growth of MS or S. mutans, the method comprising contacting the MS or S. mutans with an inhibitory effective amount of : (i) an S. salivarius extract composition or formulation of the invention; or (ii) S. salivarius K12 or an anti-MS or anti-S. mutans active extract therefrom, or a composition or formulation comprising K12 or an active extract therefrom...
DETAILED DESCRIPTION OF THE INVENTION

As noted above, the present invention is directed in a first aspect to Streptococcus salivarius strains which produce Salivaricin A2 and which exhibit anti-MS activity. When grown on TSBCaYE agar, the S. salivarius strains desirably exhibit activity against a broader spectrum of MS including S. mutans. Salivaricin A2 and an A2-producing S. salivarius strain (strain K12) are described for example in WO 01/27143 incorporated herein by reference.
In one embodiment the invention is directed to S. salivarius strain Mia and S. salivarius strains having the identifying characteristics thereof.
Strain Mia is distinct from strain K12 in its biochemical characteristics as determined using API 20 Strep kit (bioMerieux) and API 50 CH (bioMerieux) which allow study of the carbohydrate metabolism. The differences are summarised as follows: API 20 Strep kit MIA K12 p-galactosidase + Alkaline phosphatase-+ API 50 CH Glycerol-+ anaerobic L-arabinose + a-methyl-D-mannoside-+ aerobic Inulin + Glycogen + Xylitol + p-gentiobiose + Preferably, strains for use in the invention exhibit at least one, preferably at least three, more preferably at least six, and even more preferably all of the distinguishing biochemical characteristics of strain Mia.
Mia also exhibits stronger anti-MS, and in particular stronger anti-S. mutans activity than K12.
S. salivarius strain Mia is a BLIS-producing strain with activity against other bacteria, particularly streptococci, and more particularly MS, including S. mutans. S. salivarius strain Mia was deposited with Deutche Sammlung von Mikroorganismen Und Zellkulturen GmbH, Mascheroder Weg 1 b, D-38124, Braunschweig, Germany on 12 December 2001 and has been assigned Accession No. DSM 14685.
As noted above MS are considered the primary causative agents in dental caries with S. mutans being of particular significance. While BLIS-producing strains of S. salivarius active against streptococci have been reported previously, this is the first time that BLIS producing S. salivarius active against MS and S. mutans in particular, have been identified.
The S. salivarius strains of the invention exhibit broad spectrum antibacterial activity, particularly when grown on TSBCaYE agar media. The S. salivarius are therefore useful as antibacterial agents per se as well as therapeutically. In this context,"therapeutic"includes prophylactic treatment. Therapeutic uses include the treatment or prevention of microbial infections, especially streptococcal infections. The salivarius'of the invention are particularly suitable for use against MS and S. mutans. Conditions amenable to treatment with the strains or extracts of the invention include dental caries, sore throats, and bad breath.
The invention also relates to extracts obtainable from salivaricin A2-producing strains of S. salivarius and especially from strains of the invention. These active extracts may similarly be used in therapeutic formulations and methods. Extracts can be obtained using known art protocols, conveniently by cell culture and centrifugation...
One preferred formulation employs freeze dried S. salivarius of the invention in milk powder formulations in a manner similar to that previously reported for the preparation of Bifidus Milk Powder (Nagawa et al. (1988); J. Dairy Sci. 71: 1777-1782).
One orally administrable formulation of S. salivarius is a blend of freeze dried S. salivarius strains with skim milk powder or the like which has been flavoured to enhance palatability...
The formulations and compositions of the invention may further comprise one or more secondary antibacterial agents. These secondary agents may, for example, be antibiotics, or other antibacterial agent or antibacterial producing microorganisms. Useful antibacterials include nisin, and other BLIS for example. Preferably, the secondary antibacterial agent is a BLIS or BLIS producing microorganism. The BLIS may be one or more of salivaricin A, Al, A2 and B. Other antibacterial microorganisms include known S. salivarius such as K12 and K30.
S. salivarius strains of the invention are primarily found on the tongue surface. Combinations with S. salivarius that grow in dental plaque such as TOVE-R (supra) would be useful...
A currently preferred treatment protocol for dental caries comprises pre-treatment by brushing teeth with chlorhexidine gel for 2 to 5 days, preferably 3 days. A lozenge is administered 1-4 hours, preferably 2 hours after the gel. This is followed by administration of a further 2-5, preferably 3 lozenges through the day at intervals of 1-4 hours, preferably every 2 hours. This protocol is followed for 2-4 days to facilitate colonisation. For maintenance purposes 1, 2, or 3 lozenges, usually 1 to 2 lozenges are taken each day following ordinary tooth brushing. The regime is continued for as long as required...
EXPERIMENTAL

Identification -- Strain Mia was isolated from the oral cavity of a healthy adult human subject. It grows on Mitis salivarius agar at 37 C, 5% C02 with morphology typical of S. salivarius as follows:
Colony shape and size: round, 1-2 mm in diameter
Margin (edge): entire (smooth)
Elevation: convex
Colour: blue
Texture: mucoid On Blood agar [Columbia Agar Base (GIBCO) with 5% human blood] at 37 C, 5% C02 it is not haemolytic, and exhibits the following morphology :
Colony shape and size: round, < 1 mm in diameter
Margin (edge): entire (smooth)
Elevation: convex
Colour: white
Texture: mucoid When cultivated on either Blood agar or on Trypticase soy broth (BBL) + Davis agar 1.5% supplemented with 0. 1% calcium carbonate the bacterial growth appears relatively more firmly adherent to the agar surface than is typical of most S. salivarius. The API 20 Strep Identification code for the strain is 5050451, which corresponds to Streptococcus salivarius (98. 4% identity)...
Preparation of anti-MS active extract

One hundred ml of molten Trypticase Soy agar containing 2% yeast extract and 0.25% calcium carbonate was poured into a 1 L schott bottle. One ml of an overnight culture of S. salivarius MIA, grown in Todd Hewitt broth at 37 C, in 5% CO2 in air, was added to the bottle. The culture was incubated anaerobically at 37 C for 18-24 hours. One hundred ml of Trypticase Soy broth containing 2% yeast extract and 0.25% calcium carbonate was added to the bottle, which had been preincubated under anaerobic conditions. The culture was then incubated for a further 24 hours anaerobically at 37 C. The broth was centrifuged to remove the bacterial cells and then ammonium sulphate was added to 50% (w/v) and incubated at 4 C for 18 hours. The sample was then centrifuged and the pellet resuspended in 1 ml of milli-Q water. Anti-MS activity of the sample was then tested using a well diffusion assay in Blood agar plates. Fifty 1ll of the sample is added to each well and air-dried. The plates were then chloroform treated. An overnight culture of the indicator strain was spread over the top of the plate and incubated at 37 C, 5% C02 in air, for 18-24 hours...
INDUSTRIAL APPLICATION

The results above demonstrate the antibacterial effect of S. salivarius strains, particularly strain Mia against a broad spectrum of microorganisms, particularly streptococci. These strains are the first BLIS producing S. salivarius to be identified which have activity against MS, and more particularly S. mutans. The strains and related active extracts herein therefore have application in methods of therapeutically treating individuals against the harmful effects of streptococcus infection, especially in the oral cavity. These methods include treatment of dental caries in which MS or S. mutans are the primary causative agent. The S. salivarius extracts and compositions of the invention also have application in the treatment of bad breath and sore throats.

US8057790
 TREATMENT OF MALODOUR 

[ Excerpts ]
FIELD OF THE INVENTION
This invention relates to methods of inhibiting growth of anaerobic bacteria, particularly halitosis causing bacteria, and to the use of BLIS-producing Streptococcus salivarius strains, extracts thereof, and compositions containing same in the prevention or treatment of halitosis.
BACKGROUND

Halitosis or bad breath is a common complaint characterised at least in part by the production of volatile sulfur compounds. The production of such compounds is generally associated with oral bacteria, particularly certain anaerobic species. These bacteria generally inhabit oral surfaces, and particularly periodontal pockets and the dorsa of the tongue surface.
The primary source of volatile sulphur compounds (VSC's) from the subgingival microflora is from microorganisms that can be both commensal and pathogenic. Previous culture-based studies have indicated that Porphyromonas gingivalis, Prevotella intermedia (both black pigmented species, Fusobacterium nucleatum, Micromonas micros (formerly, Peptostreptococcus), Bacteroides species, Campylobacter rectus, Eikenella corrodens, Desulfovibrio species, Treponema denticola, and Eubacterium species amongst others are responsible for the production of VSC's that contribute to halitosis (as summarized by Loesche W J, Kazor C. Periodontol 2000. 2002; 28:256-79. and Khaira N, Palmer R M, Wilson R F, Scott D A, Wade W G. Oral Dis. 2000 November; 6 (6):371-5). However, recent non-culture healthy or afflicted with halitosis. Atopobium pavulum, Eubacterium sulci, Fusobacterium periodonticum, Dialister, a phylotype of streptococci, a phylotype of the uncultivated phylum TM7, and Solobacterium moorei appeared to be present in subjects with halitosis. By contrast, Streptococcus salivarius, Rothia mucilaginosa (Stomatococcus mucilaginosus), and an uncharacterized Eubacterium (strain FTB41) were commonly detected only amongst healthy individuals (Kazor, C. E. et al., J. Clin Microbiol, February 2003, pp 558-563).
Over the years various methods have been developed and tried with varying success, to prevent or at least alleviate the problem of halitosis. Current treatments focus on anti bacterial regimes to reduce numbers of oral bacteria, or agents to mask or neutralise the offensive odour. Oral rinses with chlorine dioxide (see for example, WO 95/27472 and U.S. Pat. No. 5,738,840) have been shown to have some effect in the control of halitosis, but offer only temporary relief in the order of a few days. Generally, current methods of treating halitosis require complex physical, chemical or expensive regimes to be carried out and are typically only of short term effect, as the malodour-causing oral bacteria recover to former levels after treatment is stopped.
What is sought to treat halitosis is the replacement of the disease-causing organisms, with a non-virulent commensal microorganism. To serve as an effector strain in replacement therapy, the microorganism must be able to compete successfully with the pathogenic microorganism either via competitive action (e.g. for attachment sites), and/or antibiotic action, or inhibition by other metabolism-associated by-products.
In WO 01/27143 S. salivarius strains are identified which have utility in the treatment of infections of the upper respiratory tract caused by streptococcal organisms, including treatment of sore throats caused mainly by S. pyogenes, and dental caries caused at least in part by S. sobrinus. No activity was recorded against any anaerobic microorganisms. Moreover, the treatment of halitosis is nowhere contemplated in that document.
The present invention is broadly directed to methods of at least inhibiting growth of anaerobic microorganisms using BLIS-producing S. salivarius strains or compositions comprising same, or at least provides the public with a useful choice...
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1. Example of inhibitory effect of S. salivarius K12 on black-pigmented bacteria (Prevotella species) from saliva sample.
FIG. 2A. Bar graph showing VSC levels of mouth air from two case subjects (4 and 12) over 28 days and after treatment.
FIG. 2B. Bar graph showing detection of BLIS activity of Streptococcus salivarius isolates (%) from case subjects over time by sensitive indicator microorganism Micrococcus leuteus (I1, sensitive to SAL A and B).
FIG. 2C. Bacterial counts of saliva from subject 4.
FIG. 2D. Bacterial counts of saliva from subject 12.
DETAILED DESCRIPTION OF THE INVENTION

As noted above, the present invention is directed in a first aspect to a method for at least inhibiting the growth of anaerobic bacteria sensitive to BLIS-producing S. salivarius. The method comprises contacting the sensitive bacteria with an inhibitory effective amount of a BLIS-producing S. salivarius, or an extract thereof, or a composition containing the S. salivarius or extract thereof...
Preferably, the S. salivarius strains for use in the invention are native Salivaricin B producers with activity against anaerobic bacteria, particularly black pigmented species (such as Prevotella), Eubacterium saburreum and/or Micromonas micros. Salivaricin B BLIS-producing strains with activity against anaerobic bacteria include K12, and K30 both deposited with Deutche Sammlung von Mikroorganismen Und Zellkulturen GmbH, Mascheroder Weg 1 b, D-38124, Braunschweig, Germany on 8 Oct. 1999, and 8 Oct. 1999, and assigned Accession Nos. DSM 13084 and 13085 respectively.
Strain Sal 20P3 was deposited at the Australian Government Analytical Laboratories, 1 Suakin Street, Pymble, New South Wales, Australia in July 1992 under Accession No. AGAL 92/32401.
Sal 20P3 is a producer of Salivaricin A only and has activity against at least Micromonas. Salivaricin B producers K12 and K30 have a broader range of activity against black pigmented species, Eubacterium and Micromonas at least.
S. salivarius BLIS-producers may be identified by testing potential producer strains in agar surface assays as taught in WO 01/27143. Production of Salivaricin A, A2 and B may be confirmed by comparing sequence identity and activity to those sequences and activity data given in WO 01/27143. For convenience, the amino acid sequences of Salivaricins useful in the invention are as follows:
Salivaricin  Amino Acid and Nucleic Acid Sequence
A  MKNSKDILNNAIEEVSEKELMEVAGG  (SEQ ID NO: 1) -1 
  KRGSGWIATITDDCPNSVFVCC   +1 
  ATGAATGCCATGAAAAACTCAAAAGATATTTTGAACAATGCTATCGAAGAAGTTTCTGA  (SEQ ID NO: 2)
  AAAAGAACTTATGGAAGTAGCTGGTGGTAAAAGAGGTTCAGGTTGGATTGCAACTATTA 
  CTGATGACTGTCCAAACTCAGTATTCGTTTGTTGTTAA 
A1  MKNSKDILTNAIEEVSEKELMEVAGG  (SEQ ID NO: 3)-1
  KKGSGWFATITDDCPNSVFVCC +1 
  ATGAGTTTTATGAAAAATTCAAAGGATATTTTGACTAATGCTATCGAAGAAGTTTCT  (SEQ ID NO: 4)
  GAAAAAGAACTTATGGAAGTAGCTGGTGGTAAAAAAGGTTCAGGTTGGTTTGCAACT 
  ATTACTGATGACTGTCCGAACTCAGTATTTGTTTGTTGTTAA 
A2  atg att gcc atg aaa aac tca aaa gat att ttg aac aat  (SEQ ID NO: 5)
  Met Ile Ala Met Lys Asn Ser Lys Asp Ile Leu Asn Asn  (SEQ ID NO: 6)  get atc gaa gaa gtt tct gaa aaa gaa ctt atg gaa gta  
  Ala Ile Glu Glu Val Ser Glu Lys Glu Leu Met Glu Val 
  gct ggt ggt aaa aga ggt aca ggt tgg ttt gca act att 
  Ala Gly Gly Lys Arg Gly Thr Gly Trp Phe Ala Thr Ile             -1  +1 
  act gat gac tgt cca aac tca gta ttc gtt tgt tgt taa 
  Thr Asp Asp Cys Pro Asn Ser Val Phe Val Cys Cys 
B  ttg act ctt gaa gaa ctt gat aac gtt ctt ggt get ggt  (SEQ ID NO: 7)
  Leu Thr Leu Glu Glu Leu Asp Asn Val Leu Gly Ala Gly  (SEQ ID NO: 8)
                                              -1  +1 
  ggt gga gta atc caa acc att tca cac gaa tgt cgt atg 
  Gly Gly Val Ile Gln Thr Ile Ser His Glu Cys Arg Met  
  aac tca tgg cag ttc ttg ttt act tgt tgc tct taa  
  Asn Ser Trp Gln Phe Leu Phe Thr Cys Cys Ser
The sequence for Salivaricin A1 is also given as a further BLIS useful in the invention...
As noted above black pigmented species, Eubacterium and Micromonas are considered causative agents in halitosis. While the BLIS-producing strains of S. salivarius above are known to be active against gram-positive aerobic bacteria, their activity against anaerobic bacteria, such as black pigmented species, Eubacterium and Micromonas in particular, is unexpected. All the more so because BLIS-producing organisms are typically known to act against more closely related species.
These BLIS-producing S. salivarius are therefore useful as anaerobic antibacterial agents per se as well as therapeutically. In this context, “therapeutic” includes prophylactic treatment. Therapeutic uses include the treatment or prevention of anaerobic microbial infections, especially Eubacterium and Micromonas infections, and infections by black pigmented species. The S. salivarius are particularly suitable for use against Prevotella species including P. intermedia and P. melaminogenica; Eubacterium saburreum, Micromonas micros, Streptococcus anginosus, some or all of which may be implicated in halitosis. Conditions amenable to treatment with the S. salivarius strains include halitosis (or bad breath).
Extracts obtainable from the BLIS-producing salivarius strains are also useful in the invention. Extracts include those in which the BLIS or BLIS' produced by the salivarius strain is/are provided in isolated or pure form. An “isolated” BLIS is one which has been identified and separated and/or recovered from its natural cellular environment. Extracts can be obtained using known art protocols, conveniently by cell culture and centrifugation. Routine isolation methods include ammonium sulphate precipitation, column chromatography (e.g. ion exchange, gel filtration, affinity chromatography etc.), electrophoresis, and ultimately, crystallisation (see generally “Enzyme Purification and Related Techniques”. Methods in Enzymology, 22: 233-577 (1991)). The BLIS may be purified as necessary using conventional techniques (see for example, Parente, E and Ricciardi, A. Applied Microbiol. Biotechnol 52: 628 (1999))..
EXAMPLES

Deferred Antagonism Test of Anti-Bacterial Activity

 Effect of S. Salivarius K12 Extract on Bacteria
S. salivarius K12 was grown in skim milk powder broth at 33° C. for 18 h. The bacterial cells were harvested by centrifugation and freeze-dried. One gram of freeze-dried cells were incubated in 10 ml of 95% methanol, pH 2.5 at room temperature for 2 h. The preparation was centrifuged to remove undissolved material. The toxicity of the supernatant was tested using a well diffusion assay.
Inhibition of Black-Pigmented Bacteria (Prevotella Species) in Saliva by S. Salivarius Strains

 Effect of S. salivarius K12 on Halitosis Subjects

Subjects, Treatment, Probiotic Instillation and Sample Collection
Saliva Analysis

Culture Analysis
Results

Inhibitory Effect
The testing of Streptococcus salivarius strains that were non-producers of salivaricins or that produced either salA and salB, salA only, salB only against some of the bacterial species implicated in halitosis showed that only the gram-positive bacteria were affected when tested by deferred antagonism (Table 1)...
INDUSTRIAL APPLICATION

BLIS-producing S. salivarius strains, particularly salivaricin B producing strains are active against a number of microorganisms implicated in halitosis (Tables 1, 2 and 6). More particularly, the strains are shown for the first time to be active in a maintenance regime, that is, for generating a cumulative effect against at least some anaerobic halitosis-causing organisms over a period of a week or more. This is surprising where generally S. salivarius strains are thought to be active against only closely related aerobic organisms. Halitosis-causing organisms are anaerobic and occupy niches not generally accessed by S. salivarius, The strains and related active extracts, formulations and compositions herein therefore have application in methods of prophylactically or therapeutically treating individuals against the harmful effects at least of some Eubacterium and Micromonas infections, as well as some black-pigmented colony types, especially in the oral cavity. These methods include treatment of halitosis in which these organisms are the primary causative agents. The S. salivarius extracts and compositions of the invention also have application in the treatment of sore throats.
It will be appreciated that the above description is provided by way of example only and that variations in both the materials and techniques used which are known to those persons skilled in the art are contemplated.
REFERENCES
1. Bosy, A., G. V. Kulkarni, M. Rosenberg, and C. A. McCulloch. 1994. Relationship of oral malodor to periodontitis: evidence of independence in discrete subpopulations. Periodontol 65:37-46.
2. Burton, J. P., and G. Reid. 2002. Evaluation of the bacterial vaginal flora of 20 postmenopausal women by direct (Nugent score) and molecular (polymerase chain reaction and denaturing gradient gel electrophoresis) techniques. J Infect Dis 186:1770-80.
3. De Boever, E. H., and W. J. Loesche. 1995. Assessing the contribution of anaerobic microflora of the tongue to oral malodor. J Am Dent Assoc 126:1384-93.
4. Kazor, C. E., P. M. Mitchell, A. M. Lee, L. N. Stokes, W. J. Loesche, F. E. Dewhirst, and B. J. Paster. 2003. Diversity of bacterial populations on the tongue dorsa of patients with halitosis and healthy patients. J Clin Microbiol 41:558-63.
5. Tagg, J. R., and L. V. Bannister. 1979. “Fingerprinting” beta-haemolytic streptococci by their production of and sensitivity to bacteriocine-like inhibitors. J Med Microbiol 12:397-411.
6. Walter, J., G. W. Tannock, A. Tilsala-Timisjarvi, S. Rodtong, D. M. Loach, K. Munro, and T. Alatossava. 2000. Detection and identification of gastrointestinal Lactobacillus species by using denaturing gradient gel electrophoresis and species-specific PCR primers. Appl Environ Microbiol 66:297-303.
7. Yaegaki, K., and J. M. Coil. 2000. Examination, classification, and treatment of halitosis; clinical perspectives. J Can Dent Assoc 66:257-61.


Related Patents :
CN104398537
Oral probiotic composition
Inventor(s): CHEN XIANGDONG; WANG HUI; LIU XIAOWEN
The invention relates to an oral probiotic composition, which contains Streptococcus salivarius K12, and one or more of the Chinese herb extract effective ingredients eugenol, tea polyphenol, glycyrrhizic acid, menthol, radix scrophulariae total glycoside, hericium erinaceus polysaccharide, Pachymaran, a dark plum water extract, and pueraria isoflavone. The composition can adjust oral flora balance, clean the oral cavity and improve oral air, and also has the efficacy of diminishing inflammation and relieving sore swollen throat.
US8506953
 USE AND METHODS FOR PREVENTING AND/OR TREATING ORAL MALODOUR
Inventor(s): BOETTNER MEWES; LANG CHRISTINE; VEEN MARKUS; SCHILLING MICHAEL; REINDL ANDREAS
Described is a microorganism belonging to the group of lactic acid bacteria which is able to drastically reduce the peptide concentration in saliva thereby depleting the substrate used by anaerobic microorganisms of the oral micro-flora which are the causative agent for oral malodour. Moreover, described is a microorganism belonging to the group of lactic acid bacteria which is able to stimulate the growth of Streptococcus salivarius but does not stimulate the growth of Streptococcus mutans and/or Porphyromonas gingivalis. Also described are compositions containing the above-mentioned microorganisms, their use for preventing and/or treating oral malodour and/or halitosis and to methods for preventing and/or treating oral malodour and/or halitosis
UA54411
 Method for treatment of patients with chronical generalized periodontitis
Inventor(s): NEPORADA KARINE STEPANIVNA, et al.
A method for treatment of patients with chronical generalized periodontitis provides the prescription of conventional therapy and probiotic, containing bifidobacteria and lactobacilli of Lactobacillus acidophilus type. As a probiotic the multifunctional resistent to antibiotics mylbtipobiotik "Simbiter TM acidophilous concentrated" multiprobiotic, which contains the following bifidobacteria varieties: Bifidobacterium bifidum and B. longum, and additionally it comprises the following lactobacilli varieties: Lactobacillus delbrueckii subsp. bulgaricus and L. helveticus, as well as lactic streptocokkes of Lactococcus lactis and Streptococcus salivarius ssp. Thermophilus varieties, propionic bacteria of varieties of Propionibacterium freudenreichii and Propionibacterium acidipropionici and acetic bacteria of variety Acetobacter aceti, and the multiprobiotic is prescribed topically using individual dentoalveolar caps for night, and internally one doze per day.
CA2791427
 COMPOSITION COMPRISING STREPTOCOCCUS SALIVARIUS USEFUL IN THE TREATMENT OF INFECTIONS AND/OR INFLAMMATIONS OF THE UPPER RESPIRATORY TRACT
Inventor(s): STEFANI STEFANIA [IT]; TIBERI LICIA [IT]; SANTAGATI MARIA
The present invention provides a new microbial strain of the species Streptococcus salivarius for use in the treatment of inflammatory processes with or without infectious etiology. A further object of the present invention compositions comprising said strain and uses thereof.
KR20120049488
PHARMACEUTICAL AND FOOD COMPOSITION FOR PREVENTING OR TREATING CAVITY AND PERIODONTAL DISEASE COMPRISING EXTRACT OF YACON AS EFFECTIVE COMPONENT   
Inventor: JANG MI HYANG, et al
PURPOSE: A composition containing yacon extract is provided to ensure strong antibacterial activity against bacteria causing dental caries or periodontitis. CONSTITUTION: An antibacterial composition against bacteria against dental caries or periodontitis contains yacon extract as an active ingredient. The bacteria causing dental caries are Streptococcus mutans, Streptococcus sobrinus, or Lactobacillus salivarius. A pharmaceutical composition for preventing or treating dental caries or periodontal diseases contains yacon extract as an active ingredient.